The active site of an enzyme (mark ALL that apply}: changes to conform to the substrate: is compatible with many different substrates; depending on the situation lasts only long enough to catalyze only one reaction: is the part that binds to the substrate: is the part that is permanently altered by the reaction:

Answers

Answer 1

The active site of an enzyme changes to conform to the substrate and is the part that binds to the substrate.

Both these statements are true regarding the active site of an enzyme. The active site of an enzyme is the portion of an enzyme molecule that binds substrates, where the chemical reaction occurs. As the substrate approaches the enzyme, the active site changes its conformation to accommodate the substrate's shape.

The substrate molecules are then held in place by various non-covalent interactions such as hydrogen bonding, electrostatic interactions, and van der Waals interactions. The specificity of the active site guarantees that only particular substrates will fit properly into it. This specificity is mainly determined by the enzyme's tertiary structure.

The following statements are false regarding the active site of an enzyme: It is compatible with many different substrates. Depending on the situation, it lasts only long enough to catalyze only one reaction. It is the part that is permanently altered by the reaction.

To know more about enzyme, refer here:

https://brainly.com/question/14953274#

#SPJ11


Related Questions

6. One of the big ideas in science is that an experiment can be __________________.

Answers

tested over and over again until you find the perfect solution

which best describes how water moves during osmosis apex

Answers

Osmosis: In osmosis, water always moves from an area of higher water concentration to one of lower concentration. In the diagram shown, the solute cannot pass through the selectively permeable membrane, but the water can.

fill in the blank
the high level of lactic acid in blood is a sign that __ as occured​

Answers

Answer:

fermentation

Explanation:

More precisely, lactic acid fermentation has occurred.

Hope it helps!


In guinea pigs, short fur (S) is dominant to long fur (s). Two heterozygous guinea pigs
(Ss) mate. Complete the Punnett square and then list the percentages of the
expected genotypes for their offspring.

In guinea pigs, short fur (S) is dominant to long fur (s). Two heterozygous guinea pigs(Ss) mate. Complete

Answers

Explanation:

A way I like to remember heterozygous is by remembering that the other word for heterozygous because brainly wont let me say it apparently. The same gender liking each other, so (word) is same, hetero is different.

each square would have 25% each because 100%÷4=25.

Dominant one is like mixing black and blue together,the black is gonna give a dark effect to blue so black is dominant.

Blue is recessive.

In guinea pigs, short fur (S) is dominant to long fur (s). Two heterozygous guinea pigs(Ss) mate. Complete

The percentage of the Ss is 75% while the percentage of the ss is only 25%.

Performing a cross

Given that we have the genotypes of the both parents as Ss. The Ss imples that the gene for short fur is dominant over the gene for long fur.

Now, when we perform te cross for the first generation, we will discover that we have the offspring; Ss, Ss, Ss and ss. The percentage of the Ss is 75% while the percentage of the ss is only 25%.

Learn more about genotype: https://brainly.com/question/365923

Which of the following terms or structures is properly associated only with animals?A) Hox genesB) cell wallC) autotrophyD) sexual reproductionE) chitin

Answers

The term/structure that is properly associated only with animals is sexual reproduction.Animals are the only eukaryotes that reproduce sexually.

Sexual reproduction includes the exchange of genetic material, which happens through a process called meiosis. Meiosis produces haploid cells (gametes), which fuse during fertilization to form a diploid zygote. These characteristics are unique to animals, as they are absent in fungi, plants, and bacteria. Chitin is a structure commonly found in fungi and arthropods, such as insects.

The cell wall is present in plants, fungi, and bacteria, but is absent in animals. Autotrophy is a term used to describe organisms that produce their own food, such as plants and some bacteria. Hox genes are present in all animals as they play a critical role in determining body structure and embryonic development. Thus, the term/structure that is properly associated only with animals is sexual reproduction.

To know more about Autotrophy visit the link

https://brainly.com/question/1870071

#SPJ11

Mendel crossed peas having round seeds and yellow cotyledons with peas having wrinkled seeds and green cotyledons. All the F1 plants had round seeds with yellow cotyledons. Diagram this cross through the F2 generation, using the Punnett square.

Answers

The F2 generation resulted in a ratio of 3:1 for round to wrinkled seeds, and a ratio of 3:1 for yellow to green cotyledons.

When Mendel crossed peas with round seeds and yellow cotyledons with peas with wrinkled seeds and green cotyledons, all the F1 plants had round seeds with yellow cotyledons. Mendel's cross between peas with different traits resulted in the F1 generation having only one of the traits from each parent. This is known as dominance, where one allele masks the expression of the other. In this case, the round seed and yellow cotyledon alleles were dominant over the wrinkled seed and green cotyledon alleles, respectively. The F1 plants were heterozygous for both traits, meaning they had one dominant allele and one recessive allele for each trait. When the F1 plants were crossed with each other, the resulting F2 generation had a ratio of 3:1 for both traits, indicating that the dominant allele appeared three times as often as the recessive allele. This pattern of inheritance is known as Mendelian inheritance and is based on the segregation of alleles during gamete formation and their random combination during fertilization. The Punnett square is a tool used to predict the possible genotypes of offspring based on the genotypes of the parents. In this case, the Punnett square for the F2 generation would have 16 boxes, representing all possible combinations of alleles from the F1 parents.

Learn more about Punnett Square, below:

https://brainly.com/question/29477879

#SPJ11

1. The graph below shows rate of reaction data for 2 different enzymes. One of these enzymes are found in the stomach, the other is found in the mouth.a) Which of these lines is more likely to indicate the enzyme found in the stomach? Explain.b) Both these enzymes have the same optimum pH, TRUE or FALSE?2. Explain, in terms of bonding, why the rate of reaction gradually falls once the pH increases above the optimum rather than denaturing straight away.

1. The graph below shows rate of reaction data for 2 different enzymes. One of these enzymes are found

Answers

Answer: Solid graph

Explanation: This indicates an optimum temperature for human enzyme. Pepsin is a stomach enzyme that serves to digest proteins found in ingested food. Gastric chief cells secrete pepsin as an inactive zymogen called pepsinogen. Parietal cells within the stomach lining secrete hydrochloric acid that lowers the pH of the stomach.

Based on aquatic ecology
Question 4
What is the chlorophyll a to phosphorus ratio? Why is it important
in understanding eutrophication and discuss
its application to the Australian environment? (Max 4

Answers

The chlorophyll to phosphorus ratio is a measure used in aquatic ecology to assess the nutrient status and potential for eutrophication in water bodies.

This ratio is important in understanding eutrophication because phosphorus is a key nutrient that can fuel excessive growth of algae and aquatic plants. Understanding the chlorophyll to phosphorus ratio in the Australian environment is particularly important because of the diverse aquatic ecosystems in that nation and the difficulties caused by nutrient pollution.

Australia has various types of water bodies, including rivers, lakes, estuaries, and coastal areas, which are vulnerable to eutrophication. Understanding this ratio in the Australian context can help inform targeted interventions and conservation efforts to maintain ecological health and water quality.

To learn more about phosphorus follow the link:

https://brainly.com/question/17118243

#SPJ4

----- The complete question is:

What is the chlorophyll a to phosphorus ratio? Why is it important in understanding eutrophication and discuss its application to the Australian environment? -----

At which step in Glycolysis would the cycle stop if not coupled to ATP hydrolysis?

Answers

Glycolysis stops at the end of the third step, known as phosphoenolpyruvate (PEP) formation.

PEP formation is the end of the first phase of glycolysis, and the energy-yielding steps take place in the second phase. If not coupled to ATP hydrolysis, the cycle would stop here, and no more energy can be obtained from the remaining glycolytic steps.

The third step of glycolysis involves an oxidation-reduction reaction in which the substrate (glucose) is broken down into two molecules of phosphoenolpyruvate (PEP) with the help of two NADH molecules and two ATP molecules. This reaction is irreversible, meaning it cannot be reversed without additional energy input. As such, without ATP hydrolysis, the cycle would end here, as no further energy can be produced from the remaining steps.

In summary, glycolysis stops at the third step (PEP formation) if not coupled to ATP hydrolysis. Without ATP hydrolysis, the irreversible reaction of PEP formation is the end of the cycle, and no further energy can be obtained from glycolysis.

Know more about PEP formation here:

https://brainly.com/question/13784484

#SPJ11

In what way do volcanic eruptions affect the climate? a. They cause a global temperature increase. b. They cause a global temperature decrease. c. They cause a global precipitation increase. d. They cause a global precipitation decrease.​

Answers

Answer:

Global cooling - volcanic eruptions Volcanic eruptions can intensify global warming by adding CO2 to the atmosphere. However, of greater significance is the haze effect - caused by ash and gases released during an eruption, which results in global cooling

Answer:

A. They cause a global temperature increase.

Explanation:

This is entirely dependent on a number of factors, however, typically volcanic eruptions would cause a global temperature increase, as volcanoes on eruption typically release large amounts of carbon dioxide into the atmosphere, which traps heat in the atmosphere through absorption and re-emits it back towards the earth.

Now, the other answer is correct only partially. Volcanic eruptions does not cause global cooling, but rather a local cooling on the affected areas. Affected areas with volcanic debris such as ash reflects solar radiations and may absorb some of the radiation, leading to the the targeted part of the earth being cooled momentarily. However, this is more temporary, and the amount of carbon dioxide emitted into the air would have a much longer impact in comparison.

Learn more about volcano eruptions, here:

https://brainly.com/question/26795957

Which trait is most likely to be affected by evolution?

Answers

Options C) A  trait that can be inherited by future generations  is most likely to be affected by evolution.

What is evolution?

The progressive accumulation of tiny genetic changes over time is the mechanism through which populations of living things change. Many processes, including as mutation, gene exchange, genetic drift, and natural selection, can cause these alterations.

These modifications over many generations have the potential to cause the extinction of other species as well as the creation of new species from existing ones.

Natural selection, the process by which specific features become more or less frequent in a population depending on their capacity to raise or lower an individual's chances of survival and reproduction, is what propels evolution.

Learn more about evolution:

https://brainly.com/question/30893161

#SPJ4

Full Question: Which trait is most likely to be affected by evolution?

ASNWER IN """!!A B C OR D"!!"

A a trait that only occurs in individuals after they reproduce

B a trait that has no effect on survival or reproduction

C a trait that can be inherited by future generations

D a trait with a single allele in the entire population

Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

Answers

Dragging the terms on the left to the respective blanks to complete the sentences

When two amino acid monomers are positioned so that the carboxyl group of one is adjacent to the amino group of the other, they can be joined through a dehydration reaction. This reaction forms a(n) peptide bond.

What are amino acids ?

Amino acids are monomers which make up the proteins, while proteins are made up of more than linear chain of amino acids which are known as polypeptide.

Hence we can conclude that the complete sentence is as written above.

Learn more about amino acids : https://brainly.com/question/1302816

#SPJ1

The missing part of the question is missing and I found it online

Brady took a cutting from a sweet potato vine in his family garden and placed the vine in a small vase filled with water. After about a week, tiny roots had begun to grow. What is this an example of

Answers

Answer:This is an example of asexual reproduction.

Explanation:

Reproduction is defined as the ability of living organisms to produce offspring, that is, new individuals of their type. Living organisms have developed many methods of reproducing. These can be either ASEXUAL or SEXUAL.

Asexual reproduction: In asexual reproduction, an individual produces an offspring by itself, that is, only one parent is present. This type of reproduction is common among flowering plants. Examples of asexual reproduction includes:

--> Fission

--> Budding

--> Spore formation

--> Fragmentation and

--> Vegetative propagation.

The sweet potato vine is reproduced by an asexual means known as vegetative propagation. Here, a new plant grows from any portion of an old one other than the seeds. When stem cutting are taken from the vine, new storage roots are formed within few days.

Brady took a cutting from a sweet potato vine in his family garden and placed the vine in a small vase filled with water. After about a week, tiny roots had begun to grow which is an example of - Asexual reproduction.

Asexual reproductionis a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes.Examples of asexual reproduction include:   Fission  Budding  Spore formation  Fragmentation and  Vegetative propagation.In the given scenario sweet potato is cultivated by vegetative propagation.Brady takes stem cuttings from the vines, which then root and form new storage roots.Sweet potatoes are relatively easy to propagate by rooting vine cuttings directly in the ground or in a well-drained rooting media

Thus, The given case shows an example of - asexual reproductions.

Learn more:

https://brainly.com/question/13876478

adaptations in glut4 expression in response to exercise detraining linked to downregulation of insulin-dependent pathways in cardiac but not in skeletal muscle tissue

Answers

The downregulation of insulin-dependent pathways in cardiac muscle tissue during exercise detraining may result in decreased glucose uptake and utilization by the heart, which could have implications for overall cardiac function.

The statement suggests that adaptations in GLUT4 expression, in response to exercise detraining, are associated with a decrease in insulin-dependent pathways in cardiac muscle tissue but not in skeletal muscle tissue.

1. GLUT4 expression: GLUT4 is a glucose transporter protein that plays a crucial role in glucose uptake by cells. In response to exercise, GLUT4 expression increases to facilitate glucose uptake into muscle cells, promoting energy production.

2. Exercise detraining: Exercise detraining refers to the period of reduced or discontinued physical activity after a period of regular exercise. During this period, the adaptations gained from exercise may start to reverse.

3. Insulin-dependent pathways: Insulin is a hormone that regulates glucose uptake into cells. Insulin-dependent pathways involve insulin signaling and activation of various molecules that facilitate glucose transport into cells.

Based on the statement, here is a breakdown of the key information:

- In response to exercise detraining:
 - GLUT4 expression decreases in cardiac muscle tissue.
 - Insulin-dependent pathways are downregulated in cardiac muscle tissue.
 - However, there is no change in GLUT4 expression or insulin-dependent pathways in skeletal muscle tissue.



Learn more about insulin-dependent pathways here:-

https://brainly.com/question/32253191

#SPJ11

Can someone please do these for me? I’m feeling lazy.

1. How was the idea of natural selection developed? How does evolution by natural selection happen?
2. How does evidence of organisms having common ancestors support evolution?
3. What are some reasons organisms can go extinct?
4. Be able to describe how fossil evidence, embryology, and current examples of natural selection all support evolution.
5. How do humans and evolution affect each other?

Answers

1. (A) The theory of evolution by natural selection was developed by Charles Darwin in 1850. The theory was supported by his observations of the natural world during his five-year voyage from 1831 to 1836. (B) Evolution by natural selection happens when the environment changes, organisms best suited for the new environment survive and reproduce. The favorable adaptation is passed on to the next generation. Over time, more and more organisms will have a favorable adaptation, and the population will evolve.

2. Similar traits and features among various species can provide evidence of common ancestry. It is likely that traits and features shared by a group of organisms were inherited from a common ancestor.

Similar traits and features due to common ancestry are known as homology. By studying the homology of organisms, we can infer how they are related. The more similarities organisms share, the more closely related they likely are.

3. Habitat loss is the primary cause of higher extinction rates. Other causes include habitat changes, over-exploitation of wildlife for commercial purposes, the introduction of harmful nonnative species, pollution, and the spread of diseases.

4. Fossils are essential evidence for evolution because they show that life on Earth was different in the past than it is now. Paleontologists have used fossils to study the changes that have occurred in creatures as life has evolved on Earth. Embryology proves our modern theory of evolution by the similar structures found in embryos. The greater the similarity in structure, the more closely related the species are, and the more recent their common ancestor is. Natural selection is a mechanism that enables evolution. In a population with genetic diversity, the individuals that are better adapted and possess favorable traits eventually gain an advantage. Over time, the traits of these successful organisms dominate, causing the entire species to adopt these changes.

5. Every form of life on Earth interacts over time with other organisms, as well as with its physical environment. For that reason, the evolution of one species influences the evolution of species with which it coexists by changing the natural selection pressures those species face. The classic examples of this sort of evolution, called coevolution, are predator-prey and host-parasite relationships.

because the _____________ of antimicrobial susceptibility testing uses large numbers of test tubes, this method is impractical for use in the clinical microbiology laboratory.

Answers

The broth dilution method of antimicrobial susceptibility testing, which uses large numbers of test tubes, is impractical for use in the clinical microbiology laboratory.

The broth dilution method is a widely used technique for determining the susceptibility of microorganisms to antimicrobial agents. It involves preparing multiple test tubes containing different concentrations of the antimicrobial agent and inoculating them with the test organism. The tubes are then observed for growth or inhibition of the microorganism, indicating its susceptibility to the drug. However, the use of large numbers of test tubes makes this method MIC impractical for routine use in the clinical microbiology laboratory.

The broth dilution method requires a significant amount of time, resources, and manpower to prepare and handle a large number of test tubes. Each tube needs to be accurately filled with the appropriate concentration of the antimicrobial agent, and the process becomes cumbersome and labor-intensive when dealing with numerous samples. Additionally, the method requires a relatively large volume of the antimicrobial agent, which may not be feasible in a clinical laboratory setting where limited amounts of expensive drugs are available.

As a result, clinical microbiology laboratories have adopted alternative methods, such as the disc diffusion method or automated systems, which offer more practical and efficient approaches for antimicrobial susceptibility testing. These methods allow for simultaneous testing of multiple antimicrobial agents and provide faster results, making them more suitable for routine use in the clinical setting.

Learn more about MIC here

https://brainly.com/question/31027419

#SPJ11

The pathogen Chlamydia trachomatis has several unique characteristics. Which of the following is not a characteristic of this organism?A. An extracellular form called a reticulate bodyB. Has a biphasic and unique reproductive cycleC. Humans and cats are the only known hostsD. All the characteristics listed are correct for C. trachomatis.

Answers

Humans and cats being the only known hosts is not a characteristic of the pathogen Chlamydia trachomatis.

Chlamydia trachomatis is a bacterial pathogen known for causing various sexually transmitted infections and other diseases. It exhibits several unique characteristics that distinguish it from other organisms.

The first characteristic, an extracellular form called a reticulate body, is true for Chlamydia trachomatis. The reticulate body is the metabolically active, non-infectious form of the bacterium that replicates within host cells.

The second characteristic, a biphasic and unique reproductive cycle, is also true for Chlamydia trachomatis. It has a distinctive lifecycle involving two forms: the reticulate body and the infectious elementary body. This cycle contributes to the pathogen's ability to infect and replicate within host cells.

However, the statement that humans and cats are the only known hosts for Chlamydia trachomatis is not correct. While humans are the primary host for this pathogen, it can infect other animals, including other mammals and birds. Cats are not the only known hosts for Chlamydia trachomatis.

In conclusion, the correct answer is D. All the characteristics listed (an extracellular form called a reticulate body, a biphasic and unique reproductive cycle) are correct for Chlamydia trachomatis except for the statement that humans and cats are the only known hosts.

Learn more about pathogen Chlamydia trachomatis here:

https://brainly.com/question/13051051

#SPJ11

i need help dragging the RNA nucleotides into the right places

i need help dragging the RNA nucleotides into the right places

Answers

The RNA nucleotide that can pair with the Thymine (T) at the beginning of the strand is Adenine (A).

In general, the nitrogen-containing bases adenine (A) and thymine (T) pair together, and cytosine (C) and guanine (G) pair together. Adenine and guanine are found in RNA and DNA, thymine is only found in DNA and uracil is only found in RNA.

RNA is single-stranded  molecule unlike DNA, which is made up of two strands, it can still form complementary base pairs. In RNA, thymine is substituted by uracil. So adenine will bond to uracil instead of thymine when RNA interacts with DNA and when RNA folds with itself to make a 3-dimensional structure.

To learn more about RNA , here

brainly.com/question/25979866

#SPJ1

A city in the U.S. Southwest is planning to restore some wetlands in a park running along its downtown river. A question has been raised about mosquitoes. Some think that mosquitoes will promote the bird population and that the natural beauty of the project will outweigh the risks. Others are worried that the mosquitoes might bring of the such diseases as malaria, especially as more people migrate from the south. How should city planners balance these concerns?

Answers

City planners faced with the question of balancing concerns regarding mosquitoes in wetland restoration projects need to consider both the potential benefits and risks involved. On one hand, mosquitoes can serve as a food source for birds and contribute to the biodiversity and ecological balance of the wetland ecosystem.

They play a role in supporting the bird population and enhancing the natural beauty of the park. These aspects can be important factors in promoting environmental sustainability and attracting visitors to the area. On the other hand, there are legitimate concerns about the potential risks associated with mosquitoes, particularly in terms of disease transmission. While malaria is not typically a concern in the United States, other mosquito-borne diseases such as West Nile virus and Zika virus may pose risks to public health. As migration patterns change and more people move from regions where these diseases are prevalent, the potential for transmission could increase.

To strike a balance, city planners should consider implementing measures to mitigate the risks associated with mosquitoes while maximizing the benefits of wetland restoration. This can include implementing mosquito control strategies such as monitoring and targeted insecticide use, creating habitats for natural predators of mosquitoes, and providing education and awareness programs for the public. By adopting a comprehensive approach that addresses both ecological and public health considerations, city planners can create a wetland restoration project that balances the promotion of biodiversity and natural beauty with the protection of public health.

To know more about biodiversity

brainly.com/question/13073382

#SPJ11

help please, i am confused

help please, i am confused

Answers

Answer:

a. acquired trait

b. adaptation (inherited trait)

c. adaptation (inherited trait)

d. acquired trait

I need help with number 1 and 2

I need help with number 1 and 2

Answers

1 would be that it is increasing because it shows according to my calculations thag it increased

suppose that you had a congenital condition that prevented your body from forming holocrine glands. if that were the case, which statement would be most accurate?

Answers

Among the given options, the most accurate statement would be option (c): "Your hair follicles would be unable to produce sebum, resulting in dry and brittle hair."

Holocrine glands are responsible for producing and secreting sebum, an oily substance that lubricates and moisturizes the hair and skin. Sebum plays a crucial role in maintaining the health and vitality of hair follicles. In the absence of holocrine glands, the production of sebum would be compromised.

As a result, the hair follicles would be unable to receive the necessary moisturization and nourishment provided by sebum, leading to dry and brittle hair.Sebum acts as a natural conditioner and protects the hair from becoming dry, frizzy, and prone to breakage. Without an adequate supply of sebum, the hair strands may lose their elasticity, become brittle, and have a dull appearance. Additionally, the lack of sebum can disrupt the balance of the scalp's microbiome, potentially leading to scalp issues such as dryness, itchiness, and irritation.

Therefore, the absence of holocrine glands would most likely result in hair follicles being unable to produce sebum, leading to dry and brittle hair.

For more questions on hair follicles

https://brainly.com/question/30226906

#SPJ8

Complete Question:

Suppose you had a congenital condition that prevented your body from forming holocrine glands. Which statement would be most accurate? Select the most appropriate option from the following:

a. "You would experience excessive sweating due to the dysfunction of your holocrine glands."b. "Your skin would be dry and prone to cracking and irritation."c. "Your hair follicles would be unable to produce sebum, resulting in dry and brittle hair."d. "Your nails would grow faster and stronger due to the absence of holocrine gland secretions."e. "Your body temperature regulation would be impaired due to the malfunctioning of holocrine glands."

A fox and an owl both eat forest mice. which type of relationship does the fox have with the owl?
mutualism
predation
competition
commensalism
parasitism
plaz answer quick

Answers

Answer:

Competition

Explanation:

They are both eating the same food, which means, in a given ecosystem, they essentially have to "share" food. If only one of the species existed in the ecosystem, they would have access all the forest mice. When two species eat the same food, they have to compete to make sure they can get to the mice first. "the early bird gets the worm"

Hope this helps!

The internal organs of the abdomen are called viscera. which organs constitute the solid viscera?- Pancreas- Adrenal glands- Kidneys- Ovaries- Uterus

Answers

The solid viscera refer to specific internal organs within the abdominal cavity that has a relatively solid, fixed structure. Among these organs, the pancreas, adrenal glands, and kidneys are considered solid viscera.

The pancreas is a crucial organ involved in the digestive system and endocrine systems, producing enzymes and hormones such as insulin. The adrenal glands are small, triangular-shaped glands located on top of each kidney, and they produce essential hormones like cortisol and adrenaline. The kidneys are bean-shaped organs responsible for filtering blood, removing waste products, and maintaining electrolyte balance in the body.
In contrast, the ovaries and uterus are part of the female reproductive system and are not categorized as solid viscera. The ovaries are responsible for producing ova (eggs) and secreting hormones, including estrogen and progesterone. The uterus is a muscular, hollow organ where a fertilized egg develops into a fetus during pregnancy. Although they are essential organs, they differ from solid viscera due to their functions and structures, which are more related to the reproductive system rather than the abdominal cavity's general functioning.

To learn more about solid viscera, refer:-

https://brainly.com/question/4785888

#SPJ11

How is energy released from ATP?

A.Energy is released from ATP when lipids are added
B.Energy is released from ATP when proteins are added.
c.Energy is released from ATP when a phosphate is added to ATP.
d.Energy is released from ATP when a phosphate is released.

Answers

Answer:

the answer to your question is d.

Explanation:

:)

D) —————————————————- :)

Both parents can roll their tongue, yet their child cannot. What must the parent's
genotype be?
A. Parents must both be homozygous dominant
B. Parents must both be homozygous recessive
C. Parents must both be heterozygous
D. IDK​

Answers

The answer is C Heterozygous

Explanation: the inability to roll your tongue is a recessive trait. Since both parents are heterozygous, they carry that recessive gene, so their child will have a 25% chance of having that recessive trait; and therefore, unable to roll their tongue.

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

What is the relationship between a bee and flower

Answers

Answer:

Both are living organisms.

Both reproduce.

Both undergo growth and development.

Both react to changes to the environment.

Both excrete.

Explanation:

Which organ systems are present?

Answers

Answer:

There are 11 major organ systems in the human body.

Explanation:

The 11 organ systems include the integumentary system, skeletal system, muscular system, lymphatic system, respiratory system, digestive system, nervous system, endocrine system, cardiovascular system, urinary system, and reproductive systems.

The nine major organ systems in the human body are the integumentary system, the musculoskeletal system, the respiratory system, the circulatory system, the digestive system, the excretory system, the nervous system, the endocrine system, and the reproductive system.

Brainliness please!

Answer:

The 11 organ systems include the...

1. integumentary system

2. skeletal system

3. muscular system

4. lymphatic system

5. respiratory system

6. digestive system

7. nervous system

8. endocrine system

9. cardiovascular system

10. urinary system

11. reproductive systems.

Explanation:

The are major human body organ systems.

Pls, choose me as brainliest!

The removal of undigested remains of food from the alimentary canal is called

Answers

Answer:

Egestion

Explanation:

This is because Egestion is the process where undigested food remains is removed or discharged from the alimentary canal as faeces. In Egestion, the food that refuse to digest form faeces and it is remove from the body through defecation. While exrection is the removal of wastes products like urine from the alimentary canal.

Other Questions
During each stage of a product's life cycle, the types and levels of sales, profits, and competition rise, peak, and eventually decline.The product life cycle defines the stages that new products move through as they enter, are established in, and ultimately leave the marketplace. In their life cycles, products pass through four stages: introduction, growth, maturity, and decline. The product life cycle offers a useful tool for managers to analyze the types of strategies that may be required over the life of their products. Even the strategic emphasis of a firm and its marketing mix (4Ps) strategies can be adapted from insights about the characteristics of each stage of the cycle.Read each statement and categorize it by the market attributes and consumer types that characterize each product life cycle stage. Place each item in the correct box on the chart.Market AttributeConsumer TypesIntroduction stageGrowth stageMaturity stageDecline stageReset What action can government take to assist the economy during a recession Analyse? Do you see the technology as a savior, a slayer, or somewhere in between? in ____, the dominant idea about resilience was that communities are responsible for child resilience. Which of the following is an advantage of polling organizations using Internet panels over landline panels?Group of answer choicesLandline panels are biased through self-selection, while Internet panels are not.Internet panels give more accurate responses than samples obtained through landlines.It is easier to follow up with Internet panels and track how their opinions change over time.Internet panels are always representative of the population of American Scratch Cat is facing right. There is a green ball sprite 10 steps to the right of the Scratch Cat sprite. Based on the sequence of blocks below, what will Scratch Cat say when the green flag is clicked?NothingGreen!Red!Green!Red! Green!